Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: Inflammasome priming by LPS is dependent upon ERK signaling and proteasome function *

doi: 10.4049/jimmunol.1301974

Figure Lengend Snippet: A. LPS priming induces expression of monocyte IL-1β but not IL-18. Fresh human monocytes were stimulated with LPS (1 μg/ml) for the specified time periods and then lysates analyzed for expression of proIL-18 and proIL-1β by immunoblots as compared to β-actin control. Shown is one representative blot of three. B. LPS stimulates rapid priming for ATP induced IL-18 and caspase-1 processing and release in monocytes. Monocytes were prepared and primed (step 1) as in Figure 1A for the indicated time points followed by 5 mM ATP for 30 min (step 2). Bar graphs represent released IL-1β and IL-18 from cell supernatants as determined by ELISA. Immunoblots show proIL-18, proIL-1β, and β-actin in the cell lysates and p20 caspase-1 released into supernatants, respectively. ELISA data represents the mean ± SEM for three separate monocyte donors and the blots are representative of repeated blots.

Article Snippet: Released IL-1β was quantified using a sandwich ELISA format using our rabbit polyclonal as previously reported ( 29 ) but substituting monoclonal (MAB601) from R&D Systems for the capture antibody.

Techniques: Expressing, Western Blot, Enzyme-linked Immunosorbent Assay

Journal: Mediators of Inflammation

Article Title: Associations of Trauma Severity with Mean Platelet Volume and Levels of Systemic Inflammatory Markers (IL1 β , IL6, TNF α , and CRP)

doi: 10.1155/2016/9894716

Figure Lengend Snippet: Comparison of biochemical markers within between study groups and controls.

Article Snippet: Serum TNF α , IL1 β , and IL6 levels were measured using Boster ELISA kits (Freemont, CA, USA) and Bio-Tek (Winooski, VT, USA) ELx50 and ELx800 devices.

Techniques: Comparison, Control

Journal: BMC Biotechnology

Article Title: Improving membrane based multiplex immunoassays for semi-quantitative detection of multiple cytokines in a single sample

doi: 10.1186/1472-6750-14-63

Figure Lengend Snippet: Curve fitting for IL-1β and IP-10. Visualization of the regression line (blue) fitted for the theoretical concentrations and membrane’s fluorescence readouts of IL-1β (a) and IP-10 (b) . The dots are compactly distributed around the predicted line, and the unexplained error is small. The red lines delimited the 95% of CI. The equations of the curves are: a) y = 561.73 × + 8.97 with Pearson’s r = 0.97; b) y = 1830.6 × – 79.4 with Pearson’s r = 0.91. The red dashed lines delimited the 95% confidence interval.

Article Snippet: Recombinant Human IL-1 beta and Recombinant Human CXCL10/IP-10 from R& D Systems (R& D Systems™) were reconstituted according to the manufacturer’s instructions.

Techniques: Fluorescence

Journal: BMC Biotechnology

Article Title: Improving membrane based multiplex immunoassays for semi-quantitative detection of multiple cytokines in a single sample

doi: 10.1186/1472-6750-14-63

Figure Lengend Snippet: Model diagnostics of the curve fitting of IL-1β (a) and IP-10 (b). "Residuals vs. Fitted" and "Scale-Location" show that a trend appears in the residuals distribution for concentrations below 400 ng/mL. The “Q-Q plot” suggests that residuals are not normally distributed. Whilst this does not affect the goodness of the coefficient estimation, it impairs the t-distribution and thus renders the use of p-values meaningless. The Cook’s distance suggests that 2 of the most diluted samples could be considered outliers in their influence on the model fitting. However, Cook’s distance has no unambiguous interpretation and the best decision is to look at the original distribution, where the 2 incriminated points show no indication of anomalous position. The red dashed lines delimited the 95% of CI.

Article Snippet: Recombinant Human IL-1 beta and Recombinant Human CXCL10/IP-10 from R& D Systems (R& D Systems™) were reconstituted according to the manufacturer’s instructions.

Techniques:

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification